Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682975
Length 231 bp
Fasta Format > whpc10g22
ctgcagctgaaggactgatcgacggtttaccagcaccaaagcggttaaat aaggctagtaagttcgtgtctccgtatgcagacaccagtacattgtatgg agtgttcaaaaaagaccatagattcttttctttttgtgggattaaataag gctgatgattctgtgtgtatacaaattcctataatcccaatggtaacgtg cgggtatccgctagcaaaggtaaaaaaaaaa
Download
page-top