Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682974
Length 790 bp
Fasta Format > whpc10g20
ttctccatcctcagatcagcgcagcggaagatcgaatcaatctaggtttg gcgagagccgagccgaggggaggggaggaggatggtgaaggccatggcgg gatgcccggcgaagatgaggttccggatgcccgccgagtgggagccgcac gagcagtgctggatgggctggccggagcgtccagacaactggcgggagca tgctgagccagctcgaaaaacatttgagagaactgcaattgccatttcaa agtttgagcctgtcaccatttgcgcaagtgccaaacagtatcctcgtgtc cacgagctgatggaacaccaaccgaacatcagggtggtcgagatgagcat gaatgattcctggttccgtgatactggtcccacttttattacccgtgaag gcggatctgatataggactcgcagagcaaacaatagcggggattgactgg gaatttaacgcatggggaggactcggtggtggttgctttgatgattggag tcttgacagaagcattgccaagaagatagttgagattgagaggatcccta ggtttgcacacacaatggttcttgagggtggaagcattcatgtagatgga gaaggtacatgcattacaacagaagaatgcttgttgaatcctaacaggaa ccctcacatgactaaactanagatagagaatgaactgaaggattttcttg gagtcacgaagatcatttggatacctctgggactacacggtgacnaggat acaaatgggcatgttgacaatttatgctgtttcatcaaac
Download
page-top