Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682972
Length 814 bp
Fasta Format > whpc10g18
ggcggctcccggaccgcccgtcgatcctcccctctcattcggcagccccc ctcgcatcctccgaaatcccccattccccggttcgttcctaggttctcat gagcatggaggtgctacatgatacaacagggaagaaggaagcggttgtgt actatatggatgcccccttgccatatgcaattgaagagaatttcggggga tgcttctttgaagatgatgttgatcttgcacaagttcttcaagatcagga aatagtgtatcaattaatccaaggaaatgatggaagtggtttatccagga ctcattcagatcctggttctagttgtggccatccacaaaaatcgagtggg cgaagattaacaagaggcgcaaattatgagtcacagctagctgtcgatga agctttagctagagacttgcaggcgatggaggaccaaattgctagggcaa cgatagatgacaagaagagaaaagaaggaagaaagcccgtaagttcttca acatccaacaatggcaatacttctgtgagcagatcttctcaggtattaac gaaggatgaagttgatcctgataatatgacttatgaggaactacaacaat taggggaaactattgggactgaaagtaaagggttgccagaagatgtgata gctctccttaagtcttcaacatacaaagttgggatattctcaagaaagga aaaacatgatgaatgtgtgatatgctgtatggcttacaagaaccgcgata agctgactacattgccctgtcagcatcagtaccatcgaacttgtgttgcc aaatggttgaagat
Download
page-top