Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682970
Length 154 bp
Fasta Format > whpc10g16
gtgtgganaacttgtacnagggtccccttgatgatatatatgctantgct atcacaaactgtgaccctgatggtcctcttatgctgcatgtctccaagat gattccagcatctgacaagggtaggttctttgcctttggacgtgttnttg ccgg
Download
page-top