Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682966
Length 653 bp
Fasta Format > whpc10g10
ttgctgattaccagtccaaagttttgaatctggatgatccttctgcatac cgtgatctttcaaagccagttggagcactaaacccaaaacgactaaagaa gttccaagaacggtactcgacgtttgaggatccaatcatccctaagtttc attatggttcacattactccngtgctggcacggtcttgtattaccttttc aggatggagccctttaccacattatctatacaattgcaaggtggcaaatt tgaccatgctgatcgcatgntttctgacctttctggtacatgggatagtg ttctggaagacatgagtgacgtanaanagctagtcccagagatgttttac ctcccggaggtatttaccancataaattctattgacttcgggacaactca acttggaggaaagctanattctgtagagntgcctccttgggccaagaacc ctgttgattttgtccacaaacaccggaaggctcttgagagtgagcatgtt tcgactcatttgcatcactggattgatcnaatattcggatataaacagag gggtaaagatgcngtaatggccnacaatgtgttcttctacatcacatatg agggaactgttgatattgacaaaattgcatatccantgcaacggcgagcc atg
Download
page-top