Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682963
Length 533 bp
Fasta Format > whpc10g03
gaagatctatngcgaanaagatagatcgaaaatgcctcccgagcttgcaa atgcactttctcatgaacgagaagctgttgatgattctgaaattcgtgaa cgggcnctggaggctatctatatgatcgtgatgcaggatgatggacnaaa ggccttttggtcantcnatgggccacggatactgcacgttggttatgaag acgaagaggacctgaaagtgatgggagcatatgagttgattggttctttg cttgtcggtaagggtgaaattgaacaagatcangagcaaggagaagataa gcctcantgatgggctcaactatgtacaatttgtaatctgtcttatctac ttgctgcaanaaaacagggctgtatcgcttccaatcttaagaatgttctg tcgtatggatccaaatttcttgcagtagctggcttgttctatctcctggt ttcanttttgttgtccacaatttcantgcaactatgtaagagcattanna acatgttcggtttttgcctctagaaaaanaaaa
Download
page-top