Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682957
Length 757 bp
Fasta Format > whpc10f21
aatcacaaacaccgaagaagagaggagacgagaaaggggatcgccgccgc cgccgccgccgtcgcccaggatgacgtcgatgctgtccgcgttctcgtcg tggttcgtgaacccgcgccgcaacccgctggcccgcatccacatgctcac catctccaaccgcctcaagaactacggcctgaggtacgacgacctgtatg acccctacttcgatctggacatcaaggaggcgctctgcaggctgccccgg gaggtggtcgacgcccgccaccagcgtctcaagcgcgccatggacctctc catgaagcaccagtacctccccgacgacgtccgggcactacagacaccat tcaaaagctatttgagcgacatgctggctctggtgaaaaaggaggcagca gagcgtaaagcactgggagcccttcctctctatgagagaacccttccttg aagacatcttccttgatatgcgccacagcttttgctccttgtagcatcac aatgcatgaaataaaatgcagattatgacactgttcctccttcgggtttc atgtccattgcctgtagcagtttcttgtgccccttcccaaattaattgcg acagaatttctgttgctgttgctgatataaaagtttattttggttgatgg aattgttgctatagaagtctgaacaactctgctcttggtcttttttccat tgagcaacgtttttgttgcttgcttctgggtttacgctgcccatttcaaa aaaaaaa
Download
page-top