Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682950
Length 838 bp
Fasta Format > whpc10f13
gaggagtcctctgggtcttgggtgctcctgggtcctctttctttcttctc ggcgagcgaggagcttgttgagatggggcgcggcaagatcgagatcaaga ggatcgagaactcgtccaaccgccaggtgaccttcgccaagcgccgggcc gggctggtgaagaaggcccgcgagatcggcgtgctctgcgacgccgaggt cggcgtcgtcatcttctccagcgccggcaagctctacgacttctggacgc ccaagaccacgctgccaaggatcttggagaagtaccagaccaactccggg aagatcctgtgggacgagaagcacaagagcatcagcgcggagattgacag ggtgaagaaggagaacgacaacatgcagatcgagctcaggcatatgaaag gcgaggatgtgaactcgctgcagcccaaggagctgatcgccatcgaggag gcgctcaccaacggccagaccagcctcagggacaagatgatggaccactg gaagatgcacaggaggaatgagaagatgctggaggaggagcacaagctgc tggctttgaggatgcaccagcaggacgacctgagcagcaacatgagggag atggagctcgggtaccatcagggtagggatttcacttcccagatgccgtt caccttccggctgcagcccagccaccccaacttgcaggaagacaagtagg ccaacgaatcctgccacggcctgtgtgaactgaagctcctctacctgcag gccacaactgctaccttcaatttccttgtgaaaccttaaatgtatcttcc ttttcatgtctggcttgatgaacttaacagcgctagtt
Download
page-top