Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682944
Length 595 bp
Fasta Format > whpc10f03
tcgcctcccaagatcgcagatctgctccggtgagaatccgtcgccatgtc ttccagcgaggtcgcctgcacccttgccgccctcatcctccacgatgacg ggatccccatcacttctgagaagatcgcgacggtggtgaaggctgccgga atcaaggttgaggcctactggcccgcgctcttcgccaagctcctggagaa gaggagcgtcgatgacctcatcctttccgtcggatctggtggaggtggtg ctccagctgctgctgctgctgccccggctgctggtggtgctgctgccgct gaagagaagaaagaagagaaaaaggaggaggctaaggaagagagcgatga tgacatgggcttcagcttgttcgactaagcagttcaattccagttctcct gtggaatcttttatgctaaggattacttatcttatgtgcttttaggtcga attttgcggatttaatatgtttgagacctaagtatctgtgcaatgagtac tgcaaaccaccttgggatggtctttttagaatgaaaatggttttggtgct tggttgaaaaaaaaaaaaaaaaaaaaaaaaaaancnnaaaaaaaa
Download
page-top