Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682943
Length 871 bp
Fasta Format > whpc10f02
atgcccctacttcacagtatgttcttccaaaattggttgtgactaatgtc gatctgaccgatgaggctaaagatctccttcaaaaagaagcatttctgcg tattcttgagagagataagcaagtagagtctggtggttcgaaagctcgtc ttccgttgctttctcacctgagtgttgagtttcctttggagttggacccg tgggagcttctcaaaaagcatgtactatctgactatgtaaataaggaggg acacgagttgacactaggcatcctgaacaggttatatcgcgaggcagaac aggatcaggacttcctttcatctagaactgcaacatcagtttatgaatca tttgttctgacaatagctgaaaatcttcgtgatatgtttccggcttcaga tagatcacttggcaaattgctttgtgagatgccatacctaccagaaggtg tattaaaactgctagagggtttatgttctcctggaaataatgagaagcag gacaaggatcttcagagtggtgacagggtaactcaaggtctaagtgcggt ctggaaccttatcatgttaagacctccaaaccgggacagatgtctggaca ttgctttgcagagttcaatcaatcgtatagatgaggtccgcatgaaggca atacgtttggtagcaaataaactatttccaatgacaagcatttccaaaag gattgaagattttgcaaatgaaaaacttaattcagtcctggaagtgattc cagcagctgaatctgcatcagctgctgaaatgggcacacccgaggttcac caggatggtggtttagaaaatgtatcctcggtagcagatgctctaacttt gatgtcgctgtattttgctct
Download
page-top