Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682929
Length 830 bp
Fasta Format > whpc10e04
gggtagtcagccaagagtgcaaaacaattgtttctcagtatggacaacag atcctcgacctgttgctagcagagacacagcccaaaaaggtctgctccca ggttggtctgtgcacctttgatgggactcgtggtgttagtgctggaattc ggagcgtggtcgatgatgagcctgtgaaatcgaatggcctccataccgat cccatgtgcagtgcctgtgagatggctgttgtgtggatgcagaaccaact tgcacagaacaagacccaggatctcatactagattacgttaaccagctgt gcaaccgtctgccaagccccatgggagaatcagctgtggactgtgccagc cttggatccatgcctgacattgagttcaccattagtggcaagaagtttgc gctgaaaccagaagagtatatcctgaaggttggcgaaggagctgctgccc agtgcatcagtggattcacagccatggacatcccgcctcctcgcggtcct ctctggatcctgggagacgttttcatgggcccctaccacaccgtcttcga ctacggcaagctgcgtgtcggattcgccaaggcggcctgaaagggtggtc gagcgagcgccccaccgcggaggcgaacacttgcgccgggagagagctta gcttttttactccgaatttgaccggtgctgtgtgtgtatatatatgctac atgctgcttttcaaagaccctgacatgaccaagggttgttcctaagatgg caagactgtttgtggacgtttgccccgaagatgttgaattattatgtgat aaacaacgtttgccttctagaaaaaaaaaa
Download
page-top