Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682926
Length 676 bp
Fasta Format > whpc10d18
gcgaggccggcgatggatgtcaagtgccggcgatctggaggggaaggtgg ccgtcgtgacggcttccacgcagggcatcggcctcgccatcgccgagcgc ctcggcctggagggcgccgcggtcgtcatctcctcccgcaagcagaaaaa cgtggacgaggcggtggagggcctcagggcaaaggggatcaccgttgtcg gggccgtctgccacgtctccaacgccgagcagcgcaagcacctcgtcgac acggccgtcaagaatttcggacatattgatattgttgtctccaatgccgc tgcaaatccttctgtggatagcatactanagatgaaagagtcagttcttg acaagctatgggatattaatgtcaaagcttctattcttctacttcaggac gccgcaccacatttgaggaagggatcatctgtgatactaatttcttcaat tgctggctataatcctgatgcanctttaacgatgtatggtgttacaaaga ctgccctttttggtctcacgaaggctcttgctactgagatgggcccaaat acccgtgttaactgtatagctcctgggtttgttcctacacgttttgctgg tttcctcacaactaatgagaccattagaaatgaacttatcgagaggagca tacttaanagattgggtagcgtggaa
Download
page-top