Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682923
Length 564 bp
Fasta Format > whpc10d13
ctgccctcctcttgctactcgccatcgtcgtgccgtttactcagacccag acgcagagcgcacgggacaaagctgccatggcggaagacgcggggccgct ggtgggaggcatcagtgactcgccgatggggcaagaaaacgacctcgacg tcatcgcgctcgcccgcttcgccgtctccgagcacaacaacaaggccaat gccctgctggagttcgagaatgtggtgaaggtgaagaagcaaactgttgc tggcacgatgcactacattacaatccgggtcactgaaggtggggccaaga agctctatgaagctaaggtgtgggagaaaccatgggagaactttaagaag ctcgaggagttcaagctggtggaggacgttccaagcgcataactcataag gcgcgtcccagctttgcaaggatctgcagctatggtgttgatgtagctat ctatcggacatggtttagcgtgttctcgtgtaatatcaagaataagtccg cttcttgcaagttgttttaaccacatctctaaataaaattctcagtatta ttgtaaaaaaaaaa
Download
page-top