Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682919
Length 764 bp
Fasta Format > whpc10d03
tctcacatcacccgacgcctcgatcctcctctccagatcagatcttacgc ccgcccgcccgcccgcccgaggtgagcacatgcttgtacatcccgatcag cttggagttcgttccgattggttcgtaggtcttggatccagccagcgtgg tctccctccggagttgctcgttccgattgtgctggtagcagcaactcttc tgctgcagtcttcttcgccgccaaaaggaaaagatgctctacaaaatcca ctcccatgcccaaatccaagccctgcaggcccgctccgatgagctgggcc actccaatgacatgcaggtgaatcttgtctctctggagtcggtgcgcata gcgcgcgagtcgtatgcactcctctgcccgctgatcatggagtcgaggtc ctgggcatgcccggagctggattccctctcggtcgtggcaggcttgtcgc tggaaatccaaaagctcgaggatgatgtgttaccccagctcatggttctg gaggccaagctggaacggggcgccctggaagccctcctactcatgaagaa ctcagcaattaagctcttacatctgagtaagtgctttaaggaagccttgg gcttagtgcttgacgaggaggatctggtctcagcccgagtcgaagagctg agcatagtgctaaaggatattgctgttcatgtactcgaatataattgcaa cattgcctggattcaangtgcgtctcccgtggctggtccagcgggtcacc gatgtgttggagac
Download
page-top