Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682916
Length 693 bp
Fasta Format > whpc10c19
ctaccagttccagtttagcacacanattttttcctcgggccaacctccag atccatcaacaatggcgaactctgtgtccggagtggcggtgaacgaggag tgcgtgaaggcgttccaggagctgcgggcggaccgcaagcaccggttcgt ggtgtacaagatggacgacgacgcgcagcaggtggtggtggacaaggtgg gcgcgctcgacgccaccttcgacgacctggcggcggccatgcccgccgac gactgccgctacgccgtctacgacctggacttcgtgtccgaggactcngc cggcgagaccccccgcagcaagatcttcttcatccactggtcgccggagt cggcggacgcgaggaacaagatgctgtacgccanctccacggaggggctc aagaaggagctggacggcgtgcanatcgacgtgcaggccaccgacgccag cgagctcaccctcgacatcctcaaggactacaccacctaagttaatcgat gaatcacgtacgcgcttggcatcgcgttcctgcttggagttggatcgtgt cttgtggatccaaataatgtttttccatgtgcagcggggtgtgaataatt gatgagtggttttcttttcgggattgataattgcgtggtttttctcttca agaatgataattgagtggttgatttattccttcaaaaaaaaaa
Download
page-top