Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682915
Length 618 bp
Fasta Format > whpc10c18
agcaggagacccagcagccagggctcaccggccgacccccgctcgccaac ggcaggtctggaatgttgcgaatgtcgagccctccagcaaatccgggaca gcttaccattttttatggtgggtcagtatgtgtgtatgactcagtgccac cagagaaggctcaagcaatcatgctcattgcagcagcagcagctgcggcc tcaaaaagcaatggcaccactgctgttaagcctccagcgatgtctgcgac caatgctatccaagccatgcttacgcggtcgctctcactccagagcactt ctgtagcaaatggacaacctcaggctgtcgcggatcctggctcgatttgc aagcttcaggctgatcttcccatcgccaggagacactcccttcagcgctt cctggagaagcgccgtgacaggttagcatgaatgaagagtacaagtagca gtctacgttcttctggagcgtattatgagtattatgacccccttacattt gttgttttgtgtttccacatgctgtgtatggtgtaccacagcatttagaa atgcatttgtatgaggccaagtcttcaaaaccaagtcttgtacttctgtg ccccgttcaaaaaaaaaa
Download
page-top