Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682911
Length 134 bp
Fasta Format > whpc10c08
aggatcactaataagcccctgccttcatgggcagccagccaccgtctcta ataaatatcatatgtgattttcctttgtcaaccgtggcaagacatatatg ttgtagcaacattatgtttattatcgcctgttgg
Download
page-top