Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682907
Length 789 bp
Fasta Format > whpc10b24
aaaacagttcgtagtattgcagattattatagacgaagtgcgcggcctgc aagccactttttaccggagccggtatgtactgcaagccacttgaagattg gtgcgtgctgtctatatgcatacgagtattcctttgtatactgttgacaa tacatttcatatggtgttgttcaaccctcgtgccgaattcggcacgaggt agggtttcacttgcatccattctcaacgttagcaggagcgagtgggagtc cggccatggcgccgtcgcagcccaagtcagggctcttcgtgggcatcaac aagggccacgtcgtcaccaagcgcgagctgccgcctcgcccgtccgaccg caaggggaaaggtacaaagagggtgcattttgtcaggaacttgatcaggg aggttgctggatttgctccctatgagaagcgtatcactgagcttcttaag gttggaaaggacaagcgtgcactcaaggtcgccaagagaaagcttggtac tcacaagagagcaaagaagaagagagaggagatgtcaagtgtccttagga agatgaggtctgctggtggtggtgctggtgacaagaagaaatagaacttg gctagctggtgaattttatccggaagcaaagtcctgtattaccagtccgt acctatagagctatggccattgtgttgacactatctttagcccgtggttt ctattttgagaagaccaatctttttaagatttttatacatgagtctggtg cctttgtttgattacttggtactctgctgtttattcagt
Download
page-top