Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682906
Length 706 bp
Fasta Format > whpc10b22
aagcacagcaggtgcaacactagctgcaagcacaagaagtaggcagcaat ggtgaggcatcgcctcctcgccgtgctcctcatcggggtagttgcagcct ctgccttcaaccaagcagctgccgctggccgaggccttgccgccatcgag aagtttgcagagctagagccaaagccagaaaccaaaccagagccaatgcc caaacctacgccacacccagagccagagccatgcgaacctgaaccgatgc ccaaacccaaaccaaagcccgaaccaaaacccggacaaaagcccaagccc aagccgatgccaaaaccaaagcccaagccctgctccaaaccaaagccact tcctaagcccgagccaatgccgaaacccgaaccaaagccggagcccaagc ctaatgaaccgaaaccgaagccgcctcctaagtgcaaaccaccgacggct cacaattgatgggatacttgtatatgacagttgatggaggagaccccata atggaggacaccccatacggcgccacactgtgctatttctagaataagtg gttccatttatttttattgttccatgcatgtgtgatgagtatgagtactc tgtacttattatttgcttgttggtatatgttcatctactttgtacgtgac tcgactcgttgttcttttgagtttctacacatgattgtattcattcaaaa aaaaaa
Download
page-top