Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682905
Length 285 bp
Fasta Format > whpc10b21
tttgcttcacttcatctggacgggctgcaaggctaattgccaagatacag gcccaccatgcctgatcctgtccgttgtcattcctcgtctgaaaacaaat caattgaagtggagcttcacaggtgcatttgaggcaagacaatcactcat agttagaggcctctttcccatgcttgctgatccacgtcatccggctgaat ctactagcactacaaatgaatcagtgttgaaggttgctcttgaccacggc aaagcatctggtgtgatcaagtcgcatgaccgtgt
Download
page-top