Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682889
Length 809 bp
Fasta Format > whpc10a11
gcaagttcattagttgtttctttgtcttcataagcttgttttcttacact ctccaactcccggagcatatgctggaatttattgtcagcctcatcaaatt cgtgaacagtttcctgggtgagataaggtaaaacttcatgtcatgtcaag gttttcttgaatgtttaatatcttcatcctatttcgtgtatttatcaagc aaattcttcagcatggaccacatttgaagtgcatatgcatttctgattgc ttcatcagtgaccatacaaagtttaagtgtggatgcatattgcttactga agatgtggagaatataaatgaagcagcttctttgttccttgaagtgtaac tgctaaactttaagtatgccaaaataaatatcatttatataattgtgttt accttttcattaccgtcggatcgtctgagatttggtttgtgcagccatgt atttgaaacacaccacatctctgacaagctagttgatctatccactgaaa actgttgagcaccaggcttttgtgtaccttgcggcattgccccatggcta aggggaacagccttcctagtgtagagagaatgcagacaaggagggtaaca tgtcaaatgcaggctggagttctgcaacgtaagtgaagagtatccggcgc tcgaccaaccgtacttacgtcagctcctgctcttgcacctggctagcagg gatcctggcacccactgtgaacaacattggagtactagcaggtaatgaaa ctacaaagctgcatagaagaacttctttttgaaatggggaatatactaat atcatgaag
Download
page-top