Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682886
Length 516 bp
Fasta Format > whpc10a07
tatctcctctgtagtagtactactattaccagagccgcctcccagttagc aatggcaaagtgtctcgccgtcgcgctcctgctgctggtggtgctcgcgt catgcgaagggagggagctgaatgagaaggttgcagcgacgcgtggcgca ggtgcgggtggtggcgtcggcgagtctaaggcgttggacttgcctttgct cgggggaaccggtacgggaaccagcaccattaccggcccgctggtggtgc ttcctgggatccctgctattggcccatgatcatctctggctcatgtgctg gcttacaaggagctaaagctcgccttgtcgctttagattctgtaggtagc accgccgggaaggaaaaagcggacgttttgctcatttccatgttcggtac tgagcgcctgtatcaactgtcatctgtactatctatttccagttcatgtt ctcgtatttttcgttccttgatgtgctacatgtaccatcaataaataata attactaaaaaaaaaa
Download
page-top