Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ574019
Length 353 bp
Fasta Format > rwhok20o10
gttgattcttctctttaattcnaatttnttacttgaaccgcttttttatt tggatatgggggtgagaagagattatttactctttatttcacnnncgggt atagcggatcctgtatccgtgtntaccgtatacagagatatatcgaaaag gaacttgtatctgatatctttctagaggntnntaaatctttttatttttt atatggctatggnctatttgtaggagtaaaataaggattaggctgnggag agatggctgagtggttgatagctccggtcttgaaaaccggnatagttcta ggaactatcgagggttcgaatccctcnctctccttttgcttattgnaata cgt
Download
page-top