Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ573956
Length 918 bp
Fasta Format > rwhok20k07
acgaacaaaataagataactgaacgctggctaggaatgtcgacagaagta ctcaagaaatcagccatcaaaactgactacaaagttcacgacacccaggt ggcacatatatcatcttctagatatgaagcagcaaaatagcgacttctat tttctactcagcagcagcaacctcctccgctccaggaatcacctcatctc catcagcaggcctgtcaagcttcacaccaacatcctccttgtagtcaccg tgcacctccatgagcttccccaggtcaaacttgggggccttcaggatctt caccttgcggacgtacacgttctggagggggaagatgcttgaggtggcct tctcaatctcctttccaatcacctcagggatgaacttgttcacaagctcc ttcaagtcacagcttgcagcttggttgaccatgatctcaaccatcttgcg gcggatctgtctgatctgacttgcttgggcatagcaagtgcgcttcacct ggtttgggcgtctcttcgtgaagccaatggtgaacatgcggagcatgtag ttgtcagtggtcttcacatccacatgagcctcaatgagtgtctgccactt cctcacaagagacctgagcttgtcagtggtgaagtccatgccccagaagt ttgtgaggacattcatcccttgcacatcctcagcacggagtctgatcttc ctgtaggcctggtcctcatcgttctgaagatcagctagagatacttcgaa caccctgtgcttcagaccctctgaggcaatcttggtaccctgtgtcctgg acacgagggtcttgccgacgttgcggctggtggaacagcancggcgcctt gatgtcataccactgcttcttggtgaacggatcgacgggcccttcttttt tgctaccctttcctcccc
Download
page-top