Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ573955
Length 633 bp
Fasta Format > rwhok20k05
ggtcgctaaatttaaatacaagtaggaaaagcaatgcgggctaattaaga caagcgatcccatggaccgaattacaagacacggcacgcatgaccggacc acgtactacgcatatgcagctgccgacacataataacacgaccattgcgg cggccgaactgaactgtcgagaagttgcaaaagcgcatttctctctggat ggatggacacaacacgggtcgccattgcttcagtcttgcatacagatgac atggatgataacttgttacgcgttgctcctgaaggagccgagggccttga tggcgccggccctgaggatgtactggtggtagaaggccgcgatcgccgcg ccgatcatggggccgacccagaagatccactgatcatcccaggccttgtc cttgttgtagatgacggcggcccccaggctccgggccgggttgatgccgg tgccggtgatggggatggtggccaggtggaccatgaacacggcgaagccg atcgggaggggcgccagcaccgggacgtgagagtcgcgtgcgctgcgctt ggggtcggtggcggagaagacggtgtagacgagcacgaaggtgccgatga tctccgcagcgaggccggtgcccttggagtagc
Download
page-top