Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ573907
Length 869 bp
Fasta Format > rwhok20h08
tatcatttgtattccaaatgaatgattaactgtatgtagcctcattccgg caaaattttgtatgtaaatacataaacagagcctgcaatgcgacccaaaa ctatatacgggacaggtcgcatgttcattattccttccattccatgtatc tataatattatctcagacaaccataacgcctttttccttttctctcctcc tcctgtcagagcgagcgcacgccgcgacgacccctcccgggaccaggagt gcgttgccccggggccatccatctcggtggagaaacaagagtgctttgca cgccggaacgccgtcagagtacacgcgccgaggcgggggaagagagcctc atcaatggtggtgctgcgagaacggccaccatctcctcttcttcgccgtg tgctgcaacctcggagcgtcgttctgtggaaatatcgagttgtagtgaac ctctgcccaaaagctcaacagcaccactttgttggacttctgaaccttgg gttggatctcgatgtagcacgtatccttgaacgaggtcatgacgaaaatc ttcactccgtacttgtcagcagcagcctgtaaagtcacatggtcacccca ttcaccatttcgtgatactttctccagatactcatcatatgccatgggga cgtatccatcataggcttcccggttactcttaagctggctaattatctgc tccctcacaaactcatggtggtccggagtttggtacagctgatctgatag tgcacggaactgacaattgccatcacctttcaccttgttctcagttagtt catacaacctcaacctgtctgacagcctttcatggtccatgctggcttcg tcaagtgatggaatttcac
Download
page-top