Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ573834
Length 765 bp
Fasta Format > rwhok20c17
cgaagcaggtttcatacaacacaacagggttgtaaaccaaacaccacaca gcaaacattcaattcaaacagacagaaaacagataaagccactcgggcag atcatcaggtcgcaatctcagctgctctagtactcatcaccctcatcacc atcctcaccctcgtcgaactcagcaccaacttcttcatagtccttctcca gggcagcgagatcctcacgggcctcagagaactctccctcctccatgccc tcacccacgtaccagtggacgaaggcacgcttggcgtacatcaggtcgaa cttgtggtcgatgcgggagaagacctcgacaacgctggtggagttggaga tcatgcagacggccctctggaccttggcaaggtcgccgcctgggacaacg ctgggtggctggtagttgataccacacttgaaaccagtggggcaccagtc cacaaactggatggtgcgcttcgtcttgatggtggccacagcggcgttga catccttgggcacaacatcaccacggtacatgaggcagcaggccatgtac ttgccgtggcgggggtcacacttggccatcatggaggaaggctcgaaggc gctgttggtgatctcggcaacagagagctgctcatggtaagccttctcgg ctgagatcactggggcgtangaggaaagcatgaagtggattcttgggtag ggcaccaggttggtctggaactcgttgacatcaacattcagagcaccatc aaacctcagggaagc
Download
page-top