Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ573278
Length 841 bp
Fasta Format > rwhok19a04
gggacgaagttaagaactctgcataagcaacatccaacagaacaaacacg atatgatatttaaggtatctcatacgcggcacacagatattgcacagaaa acagttctgaacttcagatgctccaaaatcaggctaacccttcatgatac cagaaagctaaagcttcatgtcagaccttcacttcttggccttggccttc tttggtgccgctgctgctggagctggagctgcagccgctggtgctggtgc atgatctctggggccctgagccaatctctcctccctcctggcatgcttcc tctccctgcttgccttgctcttggcgcgcttggcctcaaactgatcagag agggtcttctctcttgccttctcagccttggacttgtggatactctccat gaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgt catggtacatgtgcttgtcgatcttcttggcctcacggtacttgcgcaga aggcgcctcaggacgcgcatcctccgcatccacaggatcttggtggggag cctagcctccctggtacccctacgcttaccatatccagagtgacggccct tctgcttggcctcatgtgccctccttgcacgagacctggagtggatcttc tgaggcttcctgatgatgaaaccatcctttaccagcttccggatgttctg ccgggagttggccatggagatctcgttgacctcattggggtcgagccaga ccttgcccttgccgcacttgaaggacgctcgaggccaggcgcttctgcan cttcancgacaccatcttcnccgccgctccctcgtgccgaa
Download
page-top