Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ573117
Length 787 bp
Fasta Format > rwhok18g17
aacacgacacttgttacaacaaaggctatatgagggacaggttacaaata tacatccagctcaagccgccagtttggccaaaatcaccatatctaagatc ttgacctcataggtgtcgtcgagcttcacaatgccatcagaaccgtctat tcctataagttttccaacaaatccgcggaaggtaccattcatgatcttga tcctgtcactcttctttggtctgatgacctcgagctcagtcggaaggacc gtcacaatgtctccgttgcctgacgacccaagtgccacacggcaagttcc atccccaagcacttccctgaccacaccaggtccttcatcacctgccgcca agacattaactaacacatctggcaatgcccagttaacttcgccctcgcca cctattacaggagacattatatccattccagcattgcctggagtcattgg ttgaccaccaggtgtaccaggaaggtacgcagcagaatttggtgtcattg gctggccaacaggtgtggaaggcacatatgggcttggagcattcgcatag ttgccctctctaggagttgggacgtcattataactaactcctggagtatt tgcccaccctgatccaggtgttggggcttcatatggccgagctggtggtg ttcctggctggtaagctggactgcttccccaagtatcaggatttccatct tcccaattatctcttggaggactcataggagcccaggccctactacgcat cggggtccgcattccatcatgtatcggtgttgctcca
Download
page-top