Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ572937
Length 591 bp
Fasta Format > rwhok17l11
ggatccaacgatggctcgcacattgtcttgaaaactactcgccactctta gaccacccaccactcacagttgtaacatggcttaacaggagtcgatcaaa atatccacccaccactcccagttgtgatctttctgaaagaaatccagagc atgatactactgcctcctgccccgtcccttctttgattgctgctgctccg cttgttccttccctgaaacctcgcttatgtcagcatcaggtccacgagtc atgagagcgaaaaagatgttgttgagcttctccatcttctttgcgtcctg agcttgatccgtcttgaacttcaagcactcgcggtcgtcggtgaccttga gcacgagcttcccgtcgcagtgccggtacttcatacaatagcgagtggtg atggggtcggcgcggaagagctgcacggaccggtcgacgaactcgtccca tgagtcgaagtacaccatcgctgcggcggcggcgctggccggaggctagg gcttcgccgcgctgtggcgtggtctcgtcgggatctgggggtttgcgggg aggagtctgccgcgctttgaagagggctgcgttcgctagac
Download
page-top