Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ572831
Length 758 bp
Fasta Format > rwhok17e17
tgggggatcaatatcatgagtaggcgaggaagaaacaataacagaagcta aaatataaaccgacaccctgggtttagattactagatacacacacaaaca cacattgttgcctcgattgtttcctctccaccgatcaacccacgtacgca tgcacacaagatgagtatcttcacttctgctctgctctagttagactcga gctgcgcgtaccacacaccctggatcttgacatccttgggcgccttggcg ccgaggtcggtgtctgacggctgcacgctctcgaagacgccgatcacctc gccggtctccggcttgctcttggtgacgctgagcgtgatgttgcccgtgg aggaggacgcgttcttcacgttctccttggccaactcctcctcgtctcct ctgcctccggcgggtagcgccacggcgttgtcgtagccagtagagccacc acggccctttgggtcgaggaaagacgaacccctgtagctgggcacgagga agggcccgctgaagctctcgggcttgccggtggcgacgagctgcttgacg gtgaagaggaagggcacgcgctcgcctccggggagctgcacggtgacggn cgcgtantcgatgccgtccttctcctcgaacttgagggtgccgtcggcgc cgacctcnagcgggccttccatctcntcaagggtgtangtganacgggtc atgancttggtcttctggaangncnnnnnntcnntcttntgnatnncctn nnnnttna
Download
page-top