Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ572680
Length 796 bp
Fasta Format > rwhok16l21
gctcattcgacattgcctcagggtctttgctaatacagagcagctcaaag ttcacacacatgaccaccaaacgttacaactcatgtattcccatgtaaac aaggaaaaactgacagaatatcacaggctgggcccggctagttcgtcagt tccatgatagcactgactatgtcaccgtcagcagatttgagcgccttcac agccttgggcctaggcacaccggcctgggtcatcaccagttcaatgtcct taggctcaactccagtctcatcacaatcctcgtcatcctcctgaacagct gtagaagcctcagggtttgagatgacgctgctaagatcaggcgctttgaa ttgctcggcagcctgggactgcagctgtgagctcagatcctcaatcttag cctcaccgaaaatgacataggtgtcagaggcagggctcttgaatacatct ggcttggagatgacaaacaggatattcttgctcttcttgacagttacacg gctcacgccagtgatagtcttcatgccaagcttcagcatggccttcctgc tcttcttctcactcctactctgcttagatcttccacttgcatcaactccc tcaacatcatcatctttgtcatcctcgtcatcatcatcctcatcttcctc atcatcatcatcctcaactacgggctcgtctccctgcgcagcgagcttct gctcttccagaacggcgcggagcagctccgcctgcgtcgcggtctcggcc gtcatggtggttgggtgggcgggtggaggcgccggcgctgctggag
Download
page-top