Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ572643
Length 506 bp
Fasta Format > rwhok16k03
cgcaatgtactgtcctgtaaatcatcaggcaaaaggggagctacaagcct cattcatacacacttggaaaaccagcgaaaaggagcatgcatcgcgatgt gcggctgttctgggtggagacgagagtttctaaagagcggaaggtttcat ttattcaaaacatccagaggagcagctgcccttcgaatgtggatttacgc caggcatgagtaggccaacgccttctcctctgacagctcctgggcggtcg catccatcttcttcctcgagaactcatcgatcgggagcccttgaacaatt gtccattcaccaccactgcacgttactgggaaggagtagataagaccagc aggcacaccgtatgaaccatcagagtacacacccatggaaacaaatgttc cctcagcggttcccagaacccagtcacggatgtgatcacaagctgagctg gcagcagagagagcactggagagcttcctcgctttgatgattgcagcacc acgctg
Download
page-top