Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ572524
Length 809 bp
Fasta Format > rwhok16c22
angtacgtacaactcagacttagatgatgaacaattcgccactcagttta caatacacaccgacaaccgcctcaaaaaccaccaaatcaaagggatgagc acatggcgccgcgccgcgccgagaaacaaactagcctaaccaacaggtgg atacagagacccagattattcaaagtaaacacggctatggtggcgacatc ctccttgcaattaaaatgggggagctgctatacggcttactgcgccttgg cgagctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcg ggcttgacctcggcatacttgcgggtcttgagaccgcagtcggggttcac ccacaggatgttggtgtcgagcaccgcgagcatcttgttgacacggtcgg cgatctcctccttggacgggatcctgggggagtggatgtcgtacacgccc gggccaatgccggcgccgtacaccacgccctcgcggaagacggagagaag cttctcgtcggaccgcgagttctcgatggtgatcacatcggcgtccatgt tgatgatggactggatgatgtcgttgaagttggagtagcacatgtgggtg tggatctgggtggtgtcctggacaccgcanttggtgatcctgaangantg cacngnccantccnantanaaancatgctccnacttncnnantgnnanac cctctctcanannnnnctcntcnatttnnatannctnantaccnnnnnnc tcnngnnnntcnacctccttnttnattnnnanannnntntnnnannnnnn ntnnnanct
Download
page-top