Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ295490
Length 614 bp
Fasta Format > rwhsl3n09
ataagatcaagctaacacagagtcttcttatgggcaataccaaaacagga caccttaagcgcagcaacagtcaccgataacaagcaactaaaaatgtaaa gggttcgggtagtaataacggcagagaccgccctggcgcggccggccggc ctagaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacc tctcctcgagcttggccttggcggccttggcggcgcccaccttcttgtcc ttggaggtgagggagtcgggcgcgccggaggccacctccttgaggtcgac gtcgagggtatagcgggtgggcatgagatgggtgaagttgacgagcttga ggaacaccttgacgcgggacttcttggccgtcttcttggccgagtccttg cggatcaccttcttcgggtacttggccagcccggcgacgaggcagtgccc gtacgggcggtcgcgggtgccctcctcgaacacgcgcacgatcaccgcct tcttccccgcgtacctgccctgcagcaggatcaccgccttgccgggcttc aggaacttcaccatcttcgcttncttcctcaagctgcgctgcgccgccgc cggtgggttggggg
Download
page-top