Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ572500
Length 828 bp
Fasta Format > rwhok16b13
agacttagatgatgaacaattcgccactcagtttacaatacacaccgaca accgcctcaaaaaccaccaaatcaaagggatgagcacatggcgccgcgcc gcgccgagaaacaaactagcctaaccaacaggtggatacagagacccaga ttattcaaagtaaacacggctatggtggcgacatcctccttgcaattaaa atgggggagctgctatacggcttactgcgccttggcgagctcggcgcgga tctgcttggcggcctcgaccatgttggtgagggcgggcttgacctcggca tacttgcgggtcttgagaccgcagtcggggttcacccacaggatgttggt gtcgagcaccgcgagcatcttgttgacacggtcggcgatctcctccttgg acgggatcctgggggagtggatgtcgtacacgcccgggccaatgccggcg ccgtacaccacgccctcgcggaagacggagagaagcttctcgtcggaccg cgagttctcgatggtgatcacatcggcgtccatgttgatgatggactgga tgatgtcgttgaagttggagtancacatgtgggtgtggatctgggtggtg tcctggacaccgcanttggtgatcctgaangantgcacggcccantccaa ntanaaancatgctccnacttgcngantgncanaccctctctcaaancan cctcatcnatttgnataacctgaataccaccancctcnnngtcctcnacc tccttcttnattgcaanancaatctnntancaantctcnnacctcnnntg nncntttctnacctcntgncnaattcct
Download
page-top