Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ571963
Length 867 bp
Fasta Format > rwhok14a04
gaaaaacattctcagttcaacctaggactcgaacagtttacagaaaatgg tgttcagtatgtctgcaaacatgacatggacgcaacatctaagaaaatcc aacaagtaacatgcagcagctcttcagcctaagctgtggcacccttgccc ttcttcttctggagcttcctcatgtagaactccagctccttgccctccag gatgtacccatcagctctgccacactgtccagggcgagacgaaatgcagg ccagcagccttccaccgctgaactgctcctcaatgtgagagtccagtgta cgtccctgctggcgcttctcaagcttcctctggacattgttgctcttctt tgcttcctctgtggcagcagcagcaacctcagactcttgtccctcagcag catccttcttggcagctgcagcagctttcttcttcctaccgatttccact ccataatgagtcaggtaccactgcttgaaaggggcagcatcaacttgcac aatggcattcttgacaagggtctgagtcctcacaagctcattgtttgacg aattgtaaaccacatccaggagacgggtcttgcgggtcacagcctcacta ccccatgagaagttaccagtgtccagacggagagccctccacttcacgtt acctccgcgaacacggaccctcctcactgtcttgttgctcgaaagcttag tgttggctggctggcggccgagctcatactttcgcttcttcctccacgcc ttctgcttcccaccggtggcccggcgcttgtgcatggagtcacgcgagat acccatggtggcgtcggtgggcttggctccgctgctgcttcgcctcctat gcncgcgccgccgcanc
Download
page-top