Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ571947
Length 811 bp
Fasta Format > rwhok13p04
cccatgcttgactcagcatggacagaaggtatatatagatccccaacaga ctgatggttttcgatcatcatgttaacatagatgtctgtcgtactattga taagccgtagggcggatcgcgtagcatccgcagtccaccaactggagatc acttccttaagccctccatgatgtacgaaccgtagaggtccatcgagtac ttgattgcgttgatggcatcttctgctgggaggaaatcattcactgcaac ctccttgttttcattcttcttgtagtcttcaaagaagcgacggatttcct gtaggcgatgcgggggaagttcactgatgtctctgaagtgacggtactca ggatcatcagcacagacagctatgatcttgtcatctttctcaccctgatc aatcataggcataagcccaatagcacgggcacgcaggaagcaaccaggaa caacttgttcctgcatcaggacaaggacatccatcgggtcattatcctca cagagtgtgcgtggaatgaagccatagttgtgtgggtacacaactgagga gtacagaacacgatcaaccttgataagaccagttgctttgtccaactcat acttaaccttgctgcctctaggaatctcaaccacacagttgaaaactgca ggggcccctggacctatctccaggtcatgccatgggtgagcagcaacgtg cttttgagacatggaagaaaggatgcgctcgttgagagcagcagggggca tccttgatacctggtaggtcttcccatcagcttctccagccatggcggcg gggttgatctc
Download
page-top