Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ295428
Length 516 bp
Fasta Format > rwhsl3h07
gaaatgaaactgcaatgggtataaatgtttacaatctctgatgtacggcg gcagaaggatttaagtactctaaaacatttagctagaagggactaaacca ttgatcataaccaccaacaaaaatattttccttgtttacagaacaccatc tcacttcgcacttccgtttcaaacagattactttgaggtcgtcttgtcct tggtcttctgtattttcaacaccttcttcacgatcttctgctcctcaacc aagaaagcgcggatgatcctttccctcaccgcagttccagagagcactcc accatagggacggttcacagtcctgcggttcctagacaaccttgatcttt tgtattcagtaggcctgaggtggggaatcccctggatcttcttcccggtc acagggcacttggggccgctcgccctcttcttggtgtactggtacacgag cttaccacctggggtcttgacgacccgcgtctggttggacttggtggcat agctgtgcctcttccc
Download
page-top