Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ571825
Length 547 bp
Fasta Format > rwhok13h22
aacattttnttctaaaaagaccatcccaagggtggtttgcagtactcatt gcacagatacttaggtctcaaacatattaaatccgcaaaattcgacctaa aagcacataagataagtaatccttagcataaaagattccacaggagaact ggaattgaactgcttagtcgaacaagctgaagcccatgtcatcatcgctc tcttccttagcctcctcctttttctcttctttcttctcttcagcggcagc agcaccaccagcagccggggcagcagcagcagcagctggagcaccacctc caccagatccgacggaaaggatgaggtcatcgacgctcctcttctccagg agcttggcgaagagcgcgggccagtaggcctcaaccttgattccggcagc cttcaccaccgtcgcgatcttctcagaagtgatggggatcccgtcatcgt ggaggatgagggcggcaagggtgcaggcgacctcgctggaagacatggcg acggattctcaccggagcagatctgcgatcttgggaggcgatggaag
Download
page-top