Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ295366
Length 556 bp
Fasta Format > rwhsl3b19
gttgttacatagcataagaagagcctgctgcatatctccactccactcct tcagcctccattgttgtgagtcgtcgtagatggcgactggtgacttaggt gggagctcagttctcgtgatcccagacttcagatgcactcttgtacggcc catgggtcttgttcacgaacagctcctctccggtcagcacacgcttctca tctttgatgctgcacaggaccttgaagtcctcctcagggatctcccaccc gaacacctggatgttctccttgatcctctcgtctttgcttgacttgggaa tcacactcgtccccctctgcagagcccacctgatgagcacctgccccggg gtcttgttcagcttgttggccaccttttcgacaaccgggtcatgagcaag gttcttctctgaagaacccaatggtgagtaagcggtgacatggatcccgc gcttcttgcaggcctcgaacatcttgtcgttcttccaaccagggtgcatc tccatctggcaaacggccggtggaatctttgcagaccgtagcagccggtc gagctt
Download
page-top