Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ575760
Length 227 bp
Fasta Format > rwhok8h16
gaactccccattnacccnttcntcatcttgaacaagttcacgaacaggct tctctccactgggagtcttcacagtggcatggttaacatcaggatactga ctggacgagtgattaccccanataatagcattcttaacgtcanaaacttg ggacaccaagtctctcanaaatctgaccgagtgccctgttgtggtctagg cgggtcaaacaactgatgttcttctca
Download
page-top