Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ295364
Length 576 bp
Fasta Format > rwhsl3b14
aaacaggacaccttaagcgcagcaacagtcaccgataacaagcaactaaa aatgtaaagggttcgggtagtaataacggcagagaccgccctggcgcggc cggccggcctagaagcggagcttggtgaagaaccacctgttcttgccggt cttgaacctctcctcgagcttggccttggcggccttggcggcgcccacct tcttgtccttggaggtgagggagtcgggcgcgccggaggccacctccttg aggtcgacgtcgagggtatagcgggtgggcatgagatgggtgaagttgac gagcttgaggaacaccttgacgcgggacttcttggccgtcttcttggccg agtccttgcggatcaccttcttcgggtacttggccagcccggcgacgagg cagtgcccgtacgggcggtcgcgggtgccctcctcgaacacgcgcacgat caccgccttcttccccgcgtacctgccctgcagcaggatcaccgccttgc cgggcttcaggaacttcaccatcttcgcttccttcctcaagctgcgctgc gccgccgccggtgggttgggggaggg
Download
page-top