Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ575567
Length 853 bp
Fasta Format > rwhok7l02
ggtatgccataacatttccggctcccagatagagtaaccatgctgaaagt tgaaaaataaacaaaaaaaagaagatcaacaatcttcagctggcatgact ccacttcacaaaaggattagcacaccacatctatatgtactagtatcaag tagtattaactaaagacagacgcaatgacacagaaccatccttcaaaatg aggcaacaagttgagattaacacagatggcaatacgcggcagggtaactc ttgtgatctagtgcttcttgttcttcgggatcttcgacaggaccttctct tcaaagatggcataatacttcttcaattcgatcatggccttctcaccaaa agcatccaccttgtcatcgtacttctcatacagaactggcacagtgtaca gcaccacaaagactatatatgacagtgtcaaaaagttgcagtagctccca agaacagaaagaagccagagccctccaatcacaatgaggaatttcttcag atcacgaccatgaccagtctctctcaaggtaaagaagccccggttgatct catgccgcagtgatagtgcaatgtttacagtcatgtcctccgggattttc acctcagggatgttcgggggagacttgtggatgaaaatgcagacattgga atagaggaagagggttgccagggagaggatgaggcagtggcccaccaagg tgagcagatggtactccatgacctcgaacagcagccagatggcagtagcg ccagcaagcacccctccggagaccttcttgttcctccatagaacaagatc agcaggcttgccgccgccgaggacggcgtggacgggcttctcgcggccga aga
Download
page-top