Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ575158
Length 538 bp
Fasta Format > rwhok6c19
atgtgcttatactggccatcntcataccattaacattggaaggctagctg caggttcatacagcatgaagctgccttcacatgaaactatgagtacatga tatatcgtgtacctccctttttggggaattatgcatatttcaggaataat ttggatgatagtgcaaacttcatacaaatatcatgtctcatgagctatga taaggcgtgggtttgtaatcatcttcttagaaactggcatcctctgttgt cggcctcctcaagaaataacgcaagctattcgcgagaacctgttgcaaag ccttgattaatggcctgccccggtaactgacatggaattttgccttggcc agnagcccctcagngncaaattctccanattggacagcgatattgatgtc ancnatgatcttaactaaatcaaccaacaaccctggacggncagctgatt ccncaacaantaaacttctttccggaccatcgtcatagatctctatgtga gtngctatgnccacatcnnccacttccgtagggggctc
Download
page-top