Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ575038
Length 718 bp
Fasta Format > rwhok5k22
tttggataagcgtgaatacatttgtggaataaaagcttgttttgaattgg agcttcacaacatctttcttccggcaagtgctgctcctgtgctgctggct gctgctacgcaactgattcatcaacctcgcttaccaaggggccagggcac agctgcttctgctcccagaccctctgactaatgcggaacaacgatacagt actaggggaaaagctcacattggcggcagccatgtgaggaccagggggct ccggactacgtgaacgccgtcgctccatgacagggcaccgtactcgggtg tcttctgagcggccttggtcctcactgtaaccttgtatgcgagcttctgg tttgcgctgctgaagtgcagggtgctcggctcgacgatgacgtccgcgcc tttgaactttgtgaccttgacatggtacgtcgatgacggaggaccgacgt ttgtcacggtgcggtgcactgccagcggggtggacggctgatcggtgaag acggcggagatggccgggtagttgaggtcgccgggcgaactgaagctgcc cttgcatgtcatgttggagttcttggtgaagcccttgagctgcgtcggcg tcaggttctgcgtgcanaggaactccaggtactcgttctggccaatgtcg tagaccaggcctgggttgagcgctcgcaccgggtgtatgtggccggcccc gtgctcgaacggcgtgga
Download
page-top