Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ571483
Length 866 bp
Fasta Format > rwhok12e05
atgtactgatcctgtagatcatcaggcaaaaggggagctacaagcctcat tcatacacacttggaaaaccagcgaaaaggagcatgcatcgcgatgtgcg gctgttctgggtggagacgagagtttctaaagagcggaaggtttcattta ttcanaacatccnnaggagcagctgcccttcnaatgtggatttacgccag gcatgantaggncaacgccttctcctctgacagctcctgggcggtcgcat ccatcttcttcctcgagaactcatcgatcgggagcccttgaacaattgtc cattcaccaccactgcacgttactgggaaggagtagataagaccagcagg cacaccgtatgaaccatcaaagtacacncccatggaaacaaatgttccct cagcggttcccagaacccagtcacggatgtgatcacaagctgagctggca gcagagagagcactggagagcttcctcgctttgatgattgcagcaccacg ctgctggacagtggcaatgaactccccatttagccattcatcatcttgaa caagttcacgaacaggcttctctccactgggagtcttcacagtggcatgg ttaacatcaggatactgactggacgagtgattaccccagataatagcatt cttaacgtcagaaacttggacaccaagtctctcagaaatctgaccgagtg ccctgttgtggtctaggcgggtcaaacaactgatgttcttctcagggata gatggagcaaactccttcaggatgagagcattggtgtttgctgggttggc aacaaccaaaaccttgcaattgggggctgcatgagcttcaagaagcanat gcttgagctttgtana
Download
page-top