Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ571293
Length 854 bp
Fasta Format > rwhok11i21
atctagtaaacatccgttacatcaccagacatcaaaacatagttcccagt atcacgacaagtaggtcataacagcaagactcatcgatacaaaatagtgc agctctctttaacaacacaagaccaggtaagggataacagcaccaaaaat ttagagcttgtcctcgaaatcggatagaggggtcatctgctccttgaggc ccttcctcttgcggatatccgtgacgagcgtcgccgactgggtgcctggg tccaaaggatcagaagccatgatgtcccagtggtcaaacacacactgggg gaaggcctggccggacgtcgcggccctcagggtgcttgagaacccaaagg attcaatgacggggaggtaggccttgatgttgtagagcggggtaccttgc ctctgcatctcctcgaacacgtgccctctcttctgattcagaacaccata gataccaccaagcgcattctccggggcctggatctcaaccaggtacacag gctccagcagccttggcttggcagtcagctgagaagcataaatgaccctc ctggccgtgggaatgacctgaccaccacccctgtggatagcatcagtgtg gagaacaacatcacagacctcaaagcaaatgccacgcatgttctcctcag ccaacgcgccttcctttgacgcccactggaaaccagccacaacagagtcc ttgatttcattaagatactgcactcccttacacatgtcgacgaccatgtt ggggccagtcgtctcaggtccaaagcaccaaatcttcttggcaagatcct tgtcccaccccaaactcctcanacaggatcttggaccgcaccttaggatc atca
Download
page-top