Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ571275
Length 837 bp
Fasta Format > rwhok11h19
ctcataacatccaggtttcaccaaagcttacattaggacagtatgtaagg cacaagacagacaccaccaagggcacgatatgcagcgctaacagctgaac agctaaaatatacccagtacgaacaatgcccttaacaaaactcagccaat actaaaaactgcttggtgtctgaaacagtgatttggatatcaattgtgga attacttcttcttgatggcagccttggtcaccttggccccggttgggtcc ttcttctcaacgcccttgatgacaccaacagccacagtctgcctcatgtc acggacagcaaaacgaccaagaggagggtaagtggcaaaggtctccacaa ccatgggcttggtgggaatcatcttcactatgccagcatcaccattcttg aggaacttgggcagggcctccagctccttaccagaccgcctgtcgatctt ggtcaccagctcagcaaacttgacagcaatgtgtgaggtgtggcagtcca gcactggggcgtagccgttgccaatctgaccagggtggttcatgatgatg acctgggaggtgaagttggctgcctccttggcagggtcatccttggagtt ggatgcaacaaacccacgcttcagatccttcacggcaacgttcttgacgt tgaagccaacgttgtcaccaggaagcgcctccaggagagactcatggtgc atctcaacggacttgacctcagttgtcagaccagtgggaccaaaggtaac aaccataccaggcttgatgacaccagtctcaacacggccaacaggcacag ttccaatgccaccaatcttgtaaacatcctgtagggg
Download
page-top