Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ571131
Length 865 bp
Fasta Format > rwhok10p19
aaaccagcggataccacacaacatcaagatatcacacggttaaacggact ggaggcacgcatacgcgccttcgcgtaacgctgatttcctattaagcagc cgctctgtcaagagacggtttgacaaaaaaggttccagcaagaggtcaaa tacttggacctgacatggcatatacggaaggaaaatgtacccatgcttga ctcagcatggacagaaggtatatatagatccccaacagactgatggtttt cgatcatcatgttaacatagatgtctgtcgtactattgataagccgtagg gcggatcgcgtagcatccgcagtccaccaactggagatcacttccttaag ccctccatgatgtacgaaccgtagaggtccatcgagtacttgattgcgtt gatggcatcttctgctgggaggaaatcattcactgcaacctccttgtttt cattcttcttgtagtcttcaaagaagcgacggatttcctgtaggcgatgc gggggaagttcactgatgtctctgaagtgacggtactcaggatcatcagc acagacagctatgatcttgtcatctttctcaccctgatcaatcataggca taagcccaatagcacgggcacgcaggaagcaaccaggaacaacttgttcc tgcatcaggacaaggacatccatcgggtcattatcctcacagagtgtgcg tggaatgaagccatagttgtgtgggtacacaactgaggagtacagaacac gatcaaccttgataagaccagttgctttgtccaactcatacttaaccttg ctgcctctaggaatctcaaccacacagttgaaaaactgcaggggcccctg ggacctatctccagg
Download
page-top